Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Levels of Nrp1 and Nrp2 mRNA expression in freshly isolated Tw2+ cells vs Pax7+ cells, as determined by RNA-seq. (B) Western blot of NRP1 protein levels in cultured Tw2-derived myoblasts (Tw2-MB) and Pax7-derived myoblasts (Pax7-MB). GAPDH serves as a loading control. (C) Levels of Nrp1 and Nrp2 mRNA expression in Twist2-overexpressing Tw2-MB (Tw2-DM) and GFP-infected Tw2-MB (GFP-DM) after 4 days in differentiation medium, as determined by RNA-seq. (D) Genome browser shot of Twist2 binding at the Nrp1 promoter in both growth media (GM) and differentiation media (DM). (E) (Top panel) Co-immunostaining of Nrp1 (green), Twist2 (red), and Hoechst (blue) in adult mouse transverse section of quadriceps muscle. (Bottom panel) Zoomed in image of top panel. Scale: 50 µm. See also Figure S1

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Expressing, Isolation, RNA Sequencing Assay, Western Blot, Cell Culture, Derivative Assay, Infection, Binding Assay, Immunostaining

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Overexpression of Nrp1 increases repulsion of Tw2-MB from Sema3a stripes. (Top) Control Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. (Bottom) Nrp1-overexpressing Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. (C) Overexpression of Nrp1 resulted in repulsion of Pax7-MB from Sema3a stripes. (Top) Control-infected Pax7-MB (red) were seeded on Sema3a stripes (green) and analyzed 1 day after seeding. (Bottom) Nrp1-overexpresssing Pax7-MB (red) were seeded on Sema3a stripes (green). Cells were analyzed 1 day after seeding and co-stained with Hoechst (blue). Scale bar: 100 µm. (D) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4C. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. **: p <0.005. See also Figure S4. Source data for 4B and 4C are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Over Expression, Staining, Infection

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Knockdown of Nrp1 by shRNA in Tw2-MB (red) abolished Sema3a avoidance. (Top) Control shRNA (shCtrl) infected Tw2-MB 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Tw2-MB overexpressing either shNrp1–1 or shNrp1–2 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. ***: p < 0.0005, ****: p < 0.00005. (C) Western blot showing loss of NRP1 protein in Tw2-MB infected with sgRNAs targeting Nrp1. GAPDH was used as a loading control. (D) (Top) Control pLentiCrisprV2-infected Tw2-MB (red) 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Two separate Nrp1 sgRNA-infected Tw2-MB (sgNrp1–2 and sgNrp1–5) 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (E) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5D. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. See also Figure S5. Source data for 5B and E are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: shRNA, Infection, Staining, Western Blot

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Experimental scheme for chimeric fusion assay. Tw2-MB were infected with retroviruses expressing shNrp1–2, control empty vector, or Nrp1, and mixed with primary myoblasts (SCs) infected with retroviruses expressing Sema3a-EGFP in equal numbers. Cells were then differentiated for 7 days. (B) SCs over-expressing Sema3a (green) were mixed with Tw2-MB (tdTO+) infected with Nrp1 (top), control empty vector (middle), or shNrp1–2 (bottom) retroviruses and differentiated for 7 days. Cells were fixed and stained with Hoechst (blue) and an antibody against fast myosin (MY32; white). Arrow indicates chimeric myotubes that are both Sema3a+ and tdTO+; * represents myotubes that Sema3a+ only; and arrowhead represents myotubes that are tdTO+ only. Scale bar: 50 µm. (C) Quantification of percent of nuclei in chimeric fibers for Figure 6B. Percent of nuclei in chimeric fibers was calculated as the percent of the number of nuclei in chimeric fibers over the total number of nuclei (red-only, green-only, and chimeric myofibers). Three fields per sample per experiment were quantified. Three separate experiments were performed. *: p < 0.05, **: p < 0.005. See also Figure S6. Source data for 6C is provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Single Vesicle Fusion Assay, Infection, Expressing, Plasmid Preparation, Staining

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: KEY RESOURCE TABLE

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Recombinant, Isolation, Transgenic Assay, Software

Journal: Scientific Reports

Article Title: DYNC2LI1 mutations broaden the clinical spectrum of dynein-2 defects

doi: 10.1038/srep11649

Figure Lengend Snippet: ( a ) Compound heterozygous missense and nonsense mutation are located in the nucleoside triphosphate hydrolase domain of DYNC2LI1. ( b ) Model of the nucleoside triphosphate hydrolase domain of DYNC2LI1 in the wild-type and p.Thr221Ile mutant. The protein backbone is depicted as cyan tube and residue 221 is shown in space-filled presentation and colored according to the atom types. A bound nucleoside diphosphate (GDP) is shown as sticks. Alternatively, ADP may be bound at this site, which cannot be safely discriminated at the present resolution of the model. ( c ) Scheme of the primary cilium and known mutations in skeletal ciliopathies associated genes (EVC/EVC2 = Ellis-van Crefeld syndrome and WAD; NEK1 = SRTD6; TTC21B = SRTD4; IFT80 = SRTD2; IFT43 = CED3; IFT122 = CED1; IFT140 = SRTD9; IFT172 = SRTD10; WDR19 = SRTD5 and CED4; WDR35 = SRTD7 and CED2; WDR34 = SRTD11; WDR60 = SRTD8; DYNC2H1 = SRTD3; DYNC2LI1 = novel intermediate phenotype of our patients) . Abbreviations: WAD (Weyers acrofacial dysostosis), CED (cranioectodermal dysplasia), SRTD (short-rib thoracic dysplasia).

Article Snippet: Relative DYNC2LI1 expression was measured by quantitative real-time PCR using predesigned TaqMan Gene Expression Assays with the TaqMan Gene Expression Mastermix (Life Technologies) specific for all 3 isoforms (Hs00602913_m1, spanning exon 5-6), isoform 4 (Hs01005273_m1, spanning exon 6-7 of NM_001193464) and isoform 1 (Hs01011588_m1, spanning exon of 6-7 NM_016008).

Techniques: Mutagenesis, Residue

Journal: Scientific Reports

Article Title: DYNC2LI1 mutations broaden the clinical spectrum of dynein-2 defects

doi: 10.1038/srep11649

Figure Lengend Snippet: Immunofluorescence staining of 5 days starved control fibroblasts with antibodies against polyglutamylated tubulin (ciliary axoneme, red), DYNC2LI1 (green) and DAPI (DNA, blue in merge) identified localization of DYNC2LI1 to the basal body region ( a ) and to the transition zone ( b ) of the primary cilium, as well as to the centrosomes ( c ) during mitosis. Magnifications are shown in white boxes, white scale bars 10 μm.

Article Snippet: Relative DYNC2LI1 expression was measured by quantitative real-time PCR using predesigned TaqMan Gene Expression Assays with the TaqMan Gene Expression Mastermix (Life Technologies) specific for all 3 isoforms (Hs00602913_m1, spanning exon 5-6), isoform 4 (Hs01005273_m1, spanning exon 6-7 of NM_001193464) and isoform 1 (Hs01011588_m1, spanning exon of 6-7 NM_016008).

Techniques: Immunofluorescence, Staining, Control

Journal: Scientific Reports

Article Title: DYNC2LI1 mutations broaden the clinical spectrum of dynein-2 defects

doi: 10.1038/srep11649

Figure Lengend Snippet: Immunofluorescence staining of 5 days starved fibroblasts (scrambled control vs. DYNC2LI1 siRNA) with antibodies against polyglutamylated tubulin (primary cilium, red), PCNT (green) and DAPI (DNA, blue in merge). ( a,b ) No significant differences in the number of cilium presenting cells were observed, 85% of control cells and 84% of DYNC2LI1 depleted cells showed primary cilium formation (p = 0.927 [χ2-test], white scale bars 20 μm). ( c,d ) The median cilia length was 1.83 μm in scrambled control cells, whereas cilia in knockdown cells were significantly shorter with median of 1.42 μm (p = 1.205 × 10 −6 [Mann-Whitney-U test]). Magnifications are shown in white boxes, white scale bars 10 μm).

Article Snippet: Relative DYNC2LI1 expression was measured by quantitative real-time PCR using predesigned TaqMan Gene Expression Assays with the TaqMan Gene Expression Mastermix (Life Technologies) specific for all 3 isoforms (Hs00602913_m1, spanning exon 5-6), isoform 4 (Hs01005273_m1, spanning exon 6-7 of NM_001193464) and isoform 1 (Hs01011588_m1, spanning exon of 6-7 NM_016008).

Techniques: Immunofluorescence, Staining, Control, Knockdown, MANN-WHITNEY

Journal: Scientific Reports

Article Title: DYNC2LI1 mutations broaden the clinical spectrum of dynein-2 defects

doi: 10.1038/srep11649

Figure Lengend Snippet: Immunofluorescence staining of 5 days starved fibroblasts (scrambled control vs. DYNC2LI1 siRNA) with antibodies against polyglutamylated tubulin (primary cilium, red), PCNT/IFT57/IFT88 (green) and DAPI (DNA, blue in merge). ( a ) DYNC2LI1 depleted cells showed in addition to the reduced ciliary length further ciliary morphological abnormalities with bulbous tips in 14% of analyzed cilia. Scrambled control cells present normal cilia structure, but we observed as well malformations in 6% of measured control cilia (p = 0.028 [χ2-test]). ( b ) Scrambled controls and knockdown cells showed a localization of IFT57 at the basal body region of the primary cilium. In addition, knockdown of DYNC2LI1 resulted in an accumulation of IFT57 - component of IFT-B complex - in the bulbous ciliary tip (arrows). ( c ) IFT88 - another component of the IFT-B complex - is localized at the basal body region of the primary cilium in scrambled controls and knockdown cells. IFT88 is present at the ciliary tip in scrambled controls compared to a strong accumulation in the bulbous tip of DYNC2LI1 depleted cells (arrows). White scale bars 2.5 μm, three-dimensional reconstruction was performed using Imaris software (Bitplane, Zurich).

Article Snippet: Relative DYNC2LI1 expression was measured by quantitative real-time PCR using predesigned TaqMan Gene Expression Assays with the TaqMan Gene Expression Mastermix (Life Technologies) specific for all 3 isoforms (Hs00602913_m1, spanning exon 5-6), isoform 4 (Hs01005273_m1, spanning exon 6-7 of NM_001193464) and isoform 1 (Hs01011588_m1, spanning exon of 6-7 NM_016008).

Techniques: Immunofluorescence, Staining, Control, Knockdown, Software

Journal: iScience

Article Title: Cancer-specific glycosylation of CD13 impacts its detection and activity in preclinical cancer tissues

doi: 10.1016/j.isci.2023.108219

Figure Lengend Snippet: Expression of CD13 in cancer cell, CDX, and normal tissues (A) Schematic diagram of CD13 structure showing N-glycosylation sites and epitopes on the protein where the anti-CD13 antibodies used bind. (B) Reactivity of anti-CD13 antibodies to CD13 validated in CD13-KO THP-1 cells. CD13 expression in human cancer CDX and normal tissues (liver and kidney) using different epitope-binding CD13 antibodies; (C) Western blot and (E) quantified relative expression of CD13 in cancer CDX as detected by the different anti-CD13 antibodies. Band intensity measured by Image Lab Software 6.1 Software 6.1 and normalized to a β-actin loading control (D) CD13 expression in cancer cells and respective xenografts using different epitope-binding CD13 antibodies. (F) CD13 mRNA expression in cancer cells, [C], and respective xenografts, [CDX], and normal tissues. (G) CD13 mRNA expression in cancer cells, [C] and respective xenografts [CDX], and normal tissues Data shown are the mean of 3 independent experiments ±SEM. ∗∗p > 0.01 and ∗∗∗∗p > 0.0001 (two-way ANOVA).

Article Snippet: Human CD13 qPCR Primer Pair , SinoBiological , Cat# HP100141.

Techniques: Expressing, Binding Assay, Western Blot, Software

Journal: iScience

Article Title: Cancer-specific glycosylation of CD13 impacts its detection and activity in preclinical cancer tissues

doi: 10.1016/j.isci.2023.108219

Figure Lengend Snippet: Differential effect of N-de-glycosylation on CD13 antibody reactivity in human cancer CDX and normal tissues (A) Western blot analyses and (B–E) quantified fold change of the reactivity of anti-CD13 antibodies on CD13 expression in human cancer CDX and normal tissue after N-de-glycosylation in mAb 1–250 (B), mAb 400-50 (C), mAb 687–967 (D), and 3D8 (E), respectively. Mean fold change in protein band intensity was measured using Image Lab Software 6.1 and normalized to a β-actin loading control (F). HeatMap of anti-CD13 antibody reactivity to CD13 in human cancer CDX and normal tissues after N-de-glycosylation. Data shown are the mean of 3 independent experiments ±SEM. ∗∗p > 0.01, ∗∗∗p > 0.001 and ∗∗∗∗p > 0.0001 (two-way ANOVA).

Article Snippet: Human CD13 qPCR Primer Pair , SinoBiological , Cat# HP100141.

Techniques: Western Blot, Expressing, Software

Journal: iScience

Article Title: Cancer-specific glycosylation of CD13 impacts its detection and activity in preclinical cancer tissues

doi: 10.1016/j.isci.2023.108219

Figure Lengend Snippet: Differential effect of O-deglycosylation on CD13 antibody reactivity in human cancer CDX and normal tissues (A) Western blot analyses and (B–D) quantified fold change of the reactivity of anti-CD13 antibodies on CD13 in human cancer CDX and normal tissue after O-deglycosylation in mAb 1–250 (B), mAb 400-50 (C), and mAb 687–967 (D), respectively. Mean fold change in protein band intensity was measured using Image Lab Software 6.1 and normalized to a β-actin loading control (E). HeatMap of anti-CD13 antibody reactivity to CD13 in human cancer CDX and normal tissues after O-glycosylation. Data shown are the mean of 3 independent experiments ±SEM. ∗∗p > 0.01, ∗∗∗p > 0.001 and ∗∗∗∗p > 0.0001 (two-way ANOVA).

Article Snippet: Human CD13 qPCR Primer Pair , SinoBiological , Cat# HP100141.

Techniques: Western Blot, Software

Journal: iScience

Article Title: Cancer-specific glycosylation of CD13 impacts its detection and activity in preclinical cancer tissues

doi: 10.1016/j.isci.2023.108219

Figure Lengend Snippet: Human cancer CDX and normal tissue lysates were subjected to lectin affinity capture (A) Captured proteins were assessed by immunoblotting for CD13 using mAb 400–500 anti-CD13 antibody. Loading was assessed by Coomassie stain ( Figure S4 ). (B and C) Effect of sialo-glycan lectin binding on CD13 detection using mAb 400–500 anti-CD13 antibody and in cancer CDX and normal tissues. (D) Significance of glycosylation on the metabolic half live (min) of CD13 substrate in MCF-7 CDX homogenate. Data shown are the mean of 3 independent experiments ±SEM. ∗∗∗p > 0.001 and ∗∗∗∗p > 0.0001 (two-way ANOVA).

Article Snippet: Human CD13 qPCR Primer Pair , SinoBiological , Cat# HP100141.

Techniques: Western Blot, Staining, Binding Assay

Journal: iScience

Article Title: Cancer-specific glycosylation of CD13 impacts its detection and activity in preclinical cancer tissues

doi: 10.1016/j.isci.2023.108219

Figure Lengend Snippet: CD13 detection in lectin-affinity captured proteins from human cancer CDX and normal tissues

Article Snippet: Human CD13 qPCR Primer Pair , SinoBiological , Cat# HP100141.

Techniques:

Journal: iScience

Article Title: Cancer-specific glycosylation of CD13 impacts its detection and activity in preclinical cancer tissues

doi: 10.1016/j.isci.2023.108219

Figure Lengend Snippet:

Article Snippet: Human CD13 qPCR Primer Pair , SinoBiological , Cat# HP100141.

Techniques: Recombinant, Saline, SYBR Green Assay, Plasmid Preparation, Western Blot, Knock-Out

Journal: BMC Genomics

Article Title: The web-based multiplex PCR primer design software Ultiplex and the associated experimental workflow: up to 100- plex multiplicity

doi: 10.1186/s12864-021-08149-1

Figure Lengend Snippet: Comparison of different primer design software programs

Article Snippet: More importantly, multiplex PCR primer design software that can eliminate nonspecific amplification of the whole genome in multiplex PCR is rare and usually requires strenuous experimental validation.

Techniques: Comparison, Software, Multiplex Assay, Sequencing

Journal: BMC Genomics

Article Title: The web-based multiplex PCR primer design software Ultiplex and the associated experimental workflow: up to 100- plex multiplicity

doi: 10.1186/s12864-021-08149-1

Figure Lengend Snippet: Multiplex PCR experimental process and sequencing results. A GT-seq experimental process. B Final library size. C The read coverage obtained with different primer concentrations. D Sequencing depth of targets

Article Snippet: More importantly, multiplex PCR primer design software that can eliminate nonspecific amplification of the whole genome in multiplex PCR is rare and usually requires strenuous experimental validation.

Techniques: Multiplex Assay, Sequencing

Journal:

Article Title: Improved Hepatic Gene Transfer by Using an Adeno-Associated Virus Serotype 5 Vector

doi: 10.1128/JVI.76.20.10497-10502.2002

Figure Lengend Snippet: Estimation of vector gene copy number in AAV-transduced livers by quantitative PCR (3 months after vector administration). A 350-bp fragment of the hF.IX cDNA as present in the AAV-EF1α-hF.IX vector was coamplified with a 1.1-kb fragment from the endogenous murine HPRT gene using biotinylated primers (20 cycles of 95°C for 1 min, 56°C for 1 min, and 72°C for 2 min, separated on a 2% agarose gel, transferred to a nylon membrane, and visualized with the Southern light detection system from Applied Biosystems. Template for PCR was as follows: 100 ng of genomic DNA extracted from several random pieces of liver and subsequently combined for each individual animal. Each sample column represents an individual animal. standards, linearized plasmid pAAV-EF1α-hF.IX (0.01, 0.1, or 1 pg) mixed with 100 ng of genomic mouse DNA (extracted from untransduced animal); NC, negative control (template, genomic DNA from untransduced animal). Bands were analyzed by densitometric scanning, and intensities were quantitated with NIH Image 6.16 software. Shown is one representative blot. Ratios of band intensities (hF.IX band/mAAT band) are for the blot shown. Gene copy number estimates are average for two experiments.

Article Snippet: A 350-bp fragment of the hF.IX cDNA as present in the AAV-EF1α-hF.IX vector was coamplified with a 1.1-kb fragment from the endogenous murine HPRT gene using biotinylated primers (20 cycles of 95°C for 1 min, 56°C for 1 min, and 72°C for 2 min, separated on a 2% agarose gel, transferred to a nylon membrane, and visualized with the Southern light detection system from Applied Biosystems.

Techniques: Plasmid Preparation, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis, Negative Control, Software